ID: 1152859874_1152859879

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1152859874 1152859879
Species Human (GRCh38) Human (GRCh38)
Location 17:82690122-82690144 17:82690162-82690184
Sequence CCAGAAGAGTAGCTGTATTAATC CTGAAGAATCAGAGGGAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 102} {0: 1, 1: 0, 2: 5, 3: 43, 4: 469}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!