ID: 1152867943_1152867951

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1152867943 1152867951
Species Human (GRCh38) Human (GRCh38)
Location 17:82735462-82735484 17:82735501-82735523
Sequence CCCGGGCGCAGGAAGCGCGAAGC GCGCGCGGCGAGCCCGCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 83} {0: 1, 1: 0, 2: 0, 3: 10, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!