ID: 1152872730_1152872731

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1152872730 1152872731
Species Human (GRCh38) Human (GRCh38)
Location 17:82766619-82766641 17:82766645-82766667
Sequence CCGTCATTGTTTCTATGTTTTTT CTGTGTAAGTATAACTGTGTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 15, 3: 188, 4: 2755} {0: 1, 1: 0, 2: 2, 3: 18, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!