ID: 1152875111_1152875116

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1152875111 1152875116
Species Human (GRCh38) Human (GRCh38)
Location 17:82781944-82781966 17:82781963-82781985
Sequence CCACCTGTTGCCAGCAGAGGGCA GGCAGTGGTGCCACGCAGCCGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 47, 4: 289} {0: 1, 1: 0, 2: 1, 3: 16, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!