ID: 1152899299_1152899303

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1152899299 1152899303
Species Human (GRCh38) Human (GRCh38)
Location 17:82930840-82930862 17:82930853-82930875
Sequence CCTGCGCCTCCTCTTCTAGCCTC TTCTAGCCTCCACATGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 351} {0: 1, 1: 0, 2: 2, 3: 13, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!