ID: 1152899834_1152899840

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1152899834 1152899840
Species Human (GRCh38) Human (GRCh38)
Location 17:82934134-82934156 17:82934162-82934184
Sequence CCAGGAAGCCCCCTCTGGTGCTC CTGAGCGAGCTCTGCAGACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 292} {0: 1, 1: 0, 2: 2, 3: 9, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!