ID: 1152920776_1152920781

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1152920776 1152920781
Species Human (GRCh38) Human (GRCh38)
Location 17:83065508-83065530 17:83065523-83065545
Sequence CCAAGCAACTTTCCAGTTCTCAG GTTCTCAGTGGACACCAACGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 17, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!