ID: 1152921353_1152921361

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1152921353 1152921361
Species Human (GRCh38) Human (GRCh38)
Location 17:83068136-83068158 17:83068150-83068172
Sequence CCACCTGCAGGAGGCGACAGCGG CGACAGCGGGGGCGACAGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 181} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!