ID: 1152922773_1152922779

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1152922773 1152922779
Species Human (GRCh38) Human (GRCh38)
Location 17:83074029-83074051 17:83074051-83074073
Sequence CCTTCGGGGTGGTGCCAGGGGCA AGAGGGGCACAGCAAGAACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 139} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!