ID: 1153007800_1153007805

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1153007800 1153007805
Species Human (GRCh38) Human (GRCh38)
Location 18:512978-513000 18:512993-513015
Sequence CCAGCTTCCGCTCGGCTTGAGAG CTTGAGAGGGAGACCGTGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 90, 3: 43, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!