|
Left Crispr |
Right Crispr |
| Crispr ID |
1153029147 |
1153029156 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
18:697471-697493
|
18:697521-697543
|
| Sequence |
CCAGGCGCGGTGGCTCATGCCTG |
CAGGAGGACCACTTGAGATGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7065, 1: 55609, 2: 120140, 3: 162711, 4: 170813} |
{0: 1, 1: 6, 2: 248, 3: 4500, 4: 34995} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|