ID: 1153101844_1153101858

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1153101844 1153101858
Species Human (GRCh38) Human (GRCh38)
Location 18:1480539-1480561 18:1480583-1480605
Sequence CCCACCAGGTCCTGGCCTTGACA AATTTGAGATAAGATTTGGGTGG
Strand - +
Off-target summary No data {0: 41, 1: 767, 2: 2612, 3: 10960, 4: 13106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!