ID: 1153106749_1153106757

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1153106749 1153106757
Species Human (GRCh38) Human (GRCh38)
Location 18:1536802-1536824 18:1536840-1536862
Sequence CCATATTCCCTTCATACCTATGA CATCAAAAATGAACATCTTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 42, 4: 394}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!