ID: 1153190198_1153190199

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1153190198 1153190199
Species Human (GRCh38) Human (GRCh38)
Location 18:2529512-2529534 18:2529540-2529562
Sequence CCAGGAGGCTTTTTTATAGACAC ATCTGATCCTAAAATTTATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 168} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!