ID: 1153336232_1153336235

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1153336232 1153336235
Species Human (GRCh38) Human (GRCh38)
Location 18:3928556-3928578 18:3928599-3928621
Sequence CCAGGCATGGTTCCAAGTGCTTC TCTTGACAACACCTTAAAGTAGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 26, 3: 160, 4: 1511} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!