ID: 1153365360_1153365361

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1153365360 1153365361
Species Human (GRCh38) Human (GRCh38)
Location 18:4249503-4249525 18:4249541-4249563
Sequence CCAAATGAGTCAGGCAACACTTT CAGTAACCGTTCAGTAATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 167} {0: 1, 1: 0, 2: 0, 3: 1, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!