ID: 1153473568_1153473570

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1153473568 1153473570
Species Human (GRCh38) Human (GRCh38)
Location 18:5472356-5472378 18:5472378-5472400
Sequence CCTAGAGGCATCATTCTTCAAGC CAGGAAATTACTGCTGCTGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 16, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!