ID: 1153527278_1153527284

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1153527278 1153527284
Species Human (GRCh38) Human (GRCh38)
Location 18:6009200-6009222 18:6009224-6009246
Sequence CCTAAACGTAAGGGCCAGAGAGT AGTCCAGGAGTTGGGGCCTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 40, 4: 377}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!