ID: 1153557721_1153557725

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1153557721 1153557725
Species Human (GRCh38) Human (GRCh38)
Location 18:6333591-6333613 18:6333617-6333639
Sequence CCTAATTGTTTATGAATAAGATT ATGGAGAAGCAGGATGCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 403} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!