ID: 1153565594_1153565609

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1153565594 1153565609
Species Human (GRCh38) Human (GRCh38)
Location 18:6414699-6414721 18:6414727-6414749
Sequence CCCCTCTACCTGCCCGGGGATGG CCCCGCGCGGCGGCGGCCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 152} {0: 1, 1: 0, 2: 4, 3: 32, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!