ID: 1153565652_1153565670

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1153565652 1153565670
Species Human (GRCh38) Human (GRCh38)
Location 18:6414893-6414915 18:6414926-6414948
Sequence CCGCTGCCCCGCGGTGCCCGGCG GAGGGTGCACGCGCGGGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 275} {0: 1, 1: 0, 2: 0, 3: 21, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!