ID: 1153585294_1153585297

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1153585294 1153585297
Species Human (GRCh38) Human (GRCh38)
Location 18:6614658-6614680 18:6614688-6614710
Sequence CCTGGGTGATTTATAAACAACAC TTTCTTGTAGTTCTGGAGGCTGG
Strand - +
Off-target summary No data {0: 10, 1: 142, 2: 938, 3: 3552, 4: 6172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!