ID: 1153683734_1153683737

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1153683734 1153683737
Species Human (GRCh38) Human (GRCh38)
Location 18:7525275-7525297 18:7525290-7525312
Sequence CCTCCTGAATTGTCATAGCTTTG TAGCTTTGGATTTCCTGTTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 36, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!