ID: 1153688085_1153688092

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1153688085 1153688092
Species Human (GRCh38) Human (GRCh38)
Location 18:7566804-7566826 18:7566840-7566862
Sequence CCTCCGGAGCCTCAGCGATCTCC CCGCAGCCGCCGAGCAGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 124} {0: 1, 1: 0, 2: 3, 3: 23, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!