ID: 1153688319_1153688333

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1153688319 1153688333
Species Human (GRCh38) Human (GRCh38)
Location 18:7567630-7567652 18:7567675-7567697
Sequence CCTGTGCCCGCGCCCCTGGAGCC CTGTTGGCACTTTGGGGGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 289} {0: 1, 1: 0, 2: 4, 3: 37, 4: 333}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!