ID: 1153837497_1153837503

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1153837497 1153837503
Species Human (GRCh38) Human (GRCh38)
Location 18:8977093-8977115 18:8977119-8977141
Sequence CCCAAGGTGGCCGGGTGTGGCCA GCTTGGTTTTACACATTTTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 134} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!