ID: 1153900650_1153900663

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1153900650 1153900663
Species Human (GRCh38) Human (GRCh38)
Location 18:9614596-9614618 18:9614632-9614654
Sequence CCGGGCTGGCGGGGGCGCGCGCG GGGCCCGGGCCTGCCGCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 37, 4: 397} {0: 1, 1: 1, 2: 7, 3: 53, 4: 493}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!