ID: 1154047144_1154047157

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1154047144 1154047157
Species Human (GRCh38) Human (GRCh38)
Location 18:10916509-10916531 18:10916560-10916582
Sequence CCACACCTGCTGGCCCGAGTGCT CCAGCAGGCCGCTCTGAGTGTGG
Strand - +
Off-target summary No data {0: 2, 1: 13, 2: 50, 3: 258, 4: 670}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!