ID: 1154073137_1154073141

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1154073137 1154073141
Species Human (GRCh38) Human (GRCh38)
Location 18:11173481-11173503 18:11173509-11173531
Sequence CCTATTTTACATGTTTACTTTCA ATAGAGAAAAAGGCTGGGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 65, 4: 580} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!