ID: 1154111013_1154111021

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1154111013 1154111021
Species Human (GRCh38) Human (GRCh38)
Location 18:11568405-11568427 18:11568451-11568473
Sequence CCAGCCCTTCCTCTTCGTGGGCC CCATGCCACCTGTGCTGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 277} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!