ID: 1154115438_1154115454

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1154115438 1154115454
Species Human (GRCh38) Human (GRCh38)
Location 18:11609667-11609689 18:11609715-11609737
Sequence CCTCCACTGGCACCAGCGCTGCC GCTGGTGGCCCTGCTGGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 69, 4: 428} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!