ID: 1154138306_1154138312

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1154138306 1154138312
Species Human (GRCh38) Human (GRCh38)
Location 18:11800479-11800501 18:11800515-11800537
Sequence CCTGTAAGTGCCAAGAAGCAGTT GAGCAGCATTTGCTGGGAAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 36, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!