ID: 1154148219_1154148220

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1154148219 1154148220
Species Human (GRCh38) Human (GRCh38)
Location 18:11884479-11884501 18:11884504-11884526
Sequence CCAGAAAGAAAAGGTGAGGCTAG GCCCAAAGTGAGTGAGTGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 239} {0: 1, 1: 0, 2: 3, 3: 22, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!