ID: 1154173765_1154173770

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1154173765 1154173770
Species Human (GRCh38) Human (GRCh38)
Location 18:12068396-12068418 18:12068423-12068445
Sequence CCCTTGCCCCTCTTGGCGTACGT CTCCGCGCCGCCGCCGCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 32} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!