ID: 1154173769_1154173780

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1154173769 1154173780
Species Human (GRCh38) Human (GRCh38)
Location 18:12068404-12068426 18:12068443-12068465
Sequence CCTCTTGGCGTACGTGCTGCTCC CGGGGCCCACACCTGTCAGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 1, 4: 54} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!