ID: 1154194275_1154194286

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1154194275 1154194286
Species Human (GRCh38) Human (GRCh38)
Location 18:12254412-12254434 18:12254457-12254479
Sequence CCCTCATCAGGCGAGTGCCCCGC TCCAATCGCCTTGCGTTCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 65} {0: 1, 1: 0, 2: 0, 3: 2, 4: 8}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!