ID: 1154252669_1154252675

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1154252669 1154252675
Species Human (GRCh38) Human (GRCh38)
Location 18:12757261-12757283 18:12757307-12757329
Sequence CCAAAGCCTAGTAACAGGCCAAG GTTACCTGCAGAAGATGGCAGGG
Strand - +
Off-target summary No data {0: 6, 1: 192, 2: 170, 3: 125, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!