ID: 1154252672_1154252674

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1154252672 1154252674
Species Human (GRCh38) Human (GRCh38)
Location 18:12757279-12757301 18:12757306-12757328
Sequence CCAAGAGCTGTCTCTCAAAAGGA AGTTACCTGCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 181, 1: 197, 2: 163, 3: 130, 4: 293} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!