ID: 1154273101_1154273111

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1154273101 1154273111
Species Human (GRCh38) Human (GRCh38)
Location 18:12936856-12936878 18:12936904-12936926
Sequence CCCCCAGCCCCTTGGGTGCTAAT AATATTGCCCCAGCCCTGCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 6, 2: 14, 3: 44, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!