ID: 1154273104_1154273108 |
View in Genome Browser |
Spacer: -3 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1154273104 | 1154273108 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 18:12936859-12936881 | 18:12936879-12936901 |
| Sequence | CCAGCCCCTTGGGTGCTAATTCA | TCAGAGCATACACAACCTCCTGG |
| Strand | - | + |
| Off-target summary | No data | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||