ID: 1154303908_1154303930

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1154303908 1154303930
Species Human (GRCh38) Human (GRCh38)
Location 18:13217498-13217520 18:13217550-13217572
Sequence CCTGAGCCCCCGCCACGGCGGCC GTCCCCACCGCGGAGTGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 32, 4: 449} {0: 1, 1: 0, 2: 0, 3: 10, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!