ID: 1154303910_1154303935

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1154303910 1154303935
Species Human (GRCh38) Human (GRCh38)
Location 18:13217504-13217526 18:13217556-13217578
Sequence CCCCCGCCACGGCGGCCCCGGTA ACCGCGGAGTGGGAAGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 123} {0: 1, 1: 0, 2: 1, 3: 31, 4: 327}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!