ID: 1154322005_1154322011

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1154322005 1154322011
Species Human (GRCh38) Human (GRCh38)
Location 18:13361775-13361797 18:13361819-13361841
Sequence CCTCTCCATCCTAGCATGATGTC TGCCCCCAGCCAGCCAGAGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!