ID: 1154365146_1154365153

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1154365146 1154365153
Species Human (GRCh38) Human (GRCh38)
Location 18:13701185-13701207 18:13701215-13701237
Sequence CCTTTGATCCCTCAGAGCAGCTG TGGTAAGTTCTCTCAGATTTCGG
Strand - +
Off-target summary {0: 1, 1: 12, 2: 26, 3: 56, 4: 252} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!