ID: 1154415793_1154415802

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1154415793 1154415802
Species Human (GRCh38) Human (GRCh38)
Location 18:14174605-14174627 18:14174624-14174646
Sequence CCAGGTGTCTCCTCCTCCTCCTG CCTGGCACGGAGCAGCTGGGAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 12, 3: 146, 4: 1017} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!