ID: 1154446076_1154446080

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1154446076 1154446080
Species Human (GRCh38) Human (GRCh38)
Location 18:14436931-14436953 18:14436946-14436968
Sequence CCAACATTCTAGGACCCCCACAC CCCCACACCCTTGGTTCTGCAGG
Strand - +
Off-target summary No data {0: 8, 1: 0, 2: 2, 3: 20, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!