ID: 1154521880_1154521881

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1154521880 1154521881
Species Human (GRCh38) Human (GRCh38)
Location 18:15238853-15238875 18:15238874-15238896
Sequence CCAGATCACTGCTACAGGTTCTG TGAATGTTTGTCCCTCACAAAGG
Strand - +
Off-target summary No data {0: 121, 1: 848, 2: 2296, 3: 2613, 4: 2175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!