ID: 1154983468_1154983472

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1154983468 1154983472
Species Human (GRCh38) Human (GRCh38)
Location 18:21524408-21524430 18:21524456-21524478
Sequence CCTTCAAAGAGGACCTGCCTTAT TTTTAGTACAGCAGAATTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 29, 3: 19, 4: 116} {0: 1, 1: 0, 2: 2, 3: 33, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!