ID: 1155007500_1155007512

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1155007500 1155007512
Species Human (GRCh38) Human (GRCh38)
Location 18:21741513-21741535 18:21741532-21741554
Sequence CCCTCACGGGCCCCCCGGCGGCA GGCAGCGGCGGCGGCGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 61} {0: 63, 1: 1208, 2: 1776, 3: 3026, 4: 6001}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!