ID: 1155030387_1155030404

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1155030387 1155030404
Species Human (GRCh38) Human (GRCh38)
Location 18:21978949-21978971 18:21978993-21979015
Sequence CCTGTCTGCTCCGGGTGGGGTGG GCCATGTCACAGGGCAGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 246} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!